Version 0.9
Last update: August 7, 2000
For the impatient
Reading manuals is not everybody favored task, me included. But to
achieve some results with migrate you should read at least
the sections about
- Data file specifications
- Quick guide for achieving ``good'' results with migrate.
Good luck,
Peter Beerli Seattle, July 2000
Migrate calculates maximum likelihood estimates for migration rates and effective population sizes
of two populations using genetic data (Fig 1). The parameters to estimate are
,
,
,
, which are 4
effective population size
mutation rate per site per generation and effective population size
migration rate per generation in population 1 and 2, respectively. The estimation process uses an expansion of the coalescent theory (Kingman 1984a,b) which
includes migration (Hudson 1990, Nath and Griffiths 1993, Notohara 1994).
A likelihood estimate of the parameters
using genealogies
with data
would be
This is the sum over the joint probability of the data given a genealogy (this is the conventional
likelihood in a phylogenetic tree) and the probability of the coalescent.
Unfortunately, this sum has an infinite number of summands; we have to sum over all genealogies and all possible branch length. We can solve this problem by using a Markov chain Monte Carlo approach with importance
sampling due to Metropolis (1954) and Hastings (1974). For an introduction see Hammersley and Handscomb (1964) or Chib and Greenberg (1995),
and see Kuhner et al. (1995) for its application to the coalescence theory).
We bias the search path through all trees towards trees with higher likelihoods (Fig. 2)
and have then to correct for this. The likelihood formula changes to
This is very reasonable, because summands with low probabilities
will almost not contribute to the final likelihood. For more information on the base model, you should read Beerli and Felsenstein (1999) and Kuhner et al. (1995).
The approximation of the likelihood using a ratio makes it difficult to
compare different runs of the program, if the program reports a likelihood
then this is actually a ratio of likelihoods and since we recalculate the
parameters for each chain, the values for
are different
between runs, and therefore it is impossible to compare them. An escape of this
problem is to run the program using the full model (e.g.
parameters and use the likelihood ratio test for specific scenarios.
Figure 1.1:
Populations exchanging migrants with rate
per generations and with size
. The parameters are scaled by mutation rate
which is with sequence data per site per generation. The estimated parameters are therefore:
which is
and
which is
, the migration estimate is more common expressed as
which is just
.
|
|
Figure 1.2:
(A) On an imaginary, infinite likelihood surface we would need to sample every possible
genealogy and sum all these values which is not possible, but trees with low probability will not contribute much to the final likelihood, (B) by biasing towards better trees we can sample effectively from those trees with high
contribution to the final likelihood and can approximate the likelihood.
|
|
There is a difficulty with these kind of samplers that we do not know
how long we have to run the sampler to get ``accurate'' estimates.
Despite the huge literature about measures when to stop sampling, there
is still no good criteria available.
Two kind of errors can produce problems: (1) programming errors,
(2) the sampler was not run long enough.
Several
ways exist to investigate these two sources of problems,
one can check if
- the program is sampling form the right distribution:
running the sampler with no data (e.g. sequence data with all ``?????'' data)
should result
in the distribution
, the one
we sample from. [checks (1)]
- simulation studies show that we can recover parameters and
population structure that was used to create the data.
[checks (1,2)]
- comparison with other programs produce similar results. I compared
migrate with genetree (Bahlo and Griffiths 1999) and with
fluctuate (Kuhner et al. 1998). The comparison with genetree
used two populations (England and Ghana: 2.5 kb sequence data for the
beta-globin locus [Harding et al. 1997]) and the results were very similar.
For my paper on n-population I have worked out a 100-locus data set simulation
that shows that genetree and migratedeliver the same estimates, and
approximative confidence intervals, although
genetree is very slow compared to migratefor that specific
data set (Beerli and Felsenstein, in prep.).
The comparison with fluctuate was for one population, yes you can run migrate with only one population, and for a data set
created using a
migrate delivered
with a 50% confidence interval of
to
,
while fluctuate delivered a point estimate of
.
[checks (1,2)]
- the
program is sampling many different genealogies; one can show
this by plotting
a curve showing on the x-axes all sampled trees and on the y-axis
the likelihood of the genealogy (in our case this is
, Figure 1.3).
A plot of a sequence of
is not
useful because the genealogies contain different number of time intervals,
and they are not comparable.
- One can show that starting from random start parameters, the estimates
converge rather quickly after a few short chains (Figure 1.4), the updating of
the start parameters over several short chains moves the estimates to the
proper region and the remaining uncertainty is only driven by the
often huge uncertainty about the parameter estimates in the data,
the likelihood surface is flat for many parameter combinations and
the data. [checks (2)]
Figure:
Data likelihood
for all sampled genealogies:
A sample run of migration estimation using 2 populations,
the very long vertical lines mark chain boundaries (10 short and
3 long chains). Totally,
short chains
sampled genealogies
long chains
sampled
genealogies were sampled out of
total 400,000. The values for not recorded trees are
not shown.
|
|
Figure 1.4:
Convergence to the true parameter region.
Ten runs were started from a
. The data was generated using
a
.
Totally,
short chains
sampled genealogies
long chains
sampled
genealogies were sampled out of
total 400,000.
|
|
This assumes
that every
mutation will
result in a new
allele, there is no back mutation (Fig. 1.5). This model is used in all current implementations of electrophoretic data analyses packages (Biosys-1, GDA among others)
and perhaps is appropriate for this kind of data. Migrate is calculating the parameters for
each locus independently and summarizes at the end taking the likelihood surfaces of each locus into account.
These mean-parameters can be found by either assuming that the mutation rate has no variation
(as all, at least those I know, other programs do) or uses a
distributed mutation rate
with shape parameter
which is in this case
Figure 1.5:
Left: Mobility of electrophoretic marker in an electric field. the alleles a,b,c,.. describe a possible sequence of mutation, their mobility is not correlated with the mutational history. Right: The probability that a given allele is not mutating during some time,
this is a simple exponential relationship.
|
|
The ladder model was invented by Ohta and Kimura (1973, 1978) for electrophoretic markers, but was not as good as expected in describing real electrophoretic alleles. For microsatellites this model seems
much more appropriate (e.g. Valdes et al. 1993, but see Di Rienzo et al. 1994), here obviously change happens mostly by slippage of the two DNA strands
creating with higher probability a new allele which is only 1 step apart from the old than one
which 2 steps apart (Fig. 1.6). Summarizing over loci can be done
either by assuming the mutation rate is Gamma distributed or constant.
This assumes, of course, independence between loci.
Figure 1.6:
Left: Number of repeat changes of a microsatellite marker. The probability to have a slippage of only one repeat is higher than the slippage of more than one repeat, in a given time, here time=0.1. Right: The probability that a change of 0,1,2,.. steps is occurring during some time.
|
|
This replaces the discrete stepwise mutation model with a continuous Brownian motion model
The results are very similar to the exact stepwise mutation model, but the parameter
estimation is several times faster.
This is work still in progress (Felsenstein and Beerli, in prep.).
Migrate implements the sequence model of Felsenstein (1984) available in dnaml (PHYLIP 4.0, Felsenstein 1997)(Fig. 1.7). The transition probabilities were published by Kishino and Hasegawa (1989). Migrate does not allow for recombinations and therefore is only well suited for mitochondrial sequences or other non-recombining DNA stretches. Summarizing over "loci" assumes in addition that the loci are unlinked. The mutation rate among loci may be
either constant or following a Gamma distribution.
Like dnaml, Migrate also allows for different evolutionary rates, mutation categories and autocorrelation, although
any use of these additional features can slow done to program to a crawl, but this may change
in the future as computers double their speed roughly every 2 years.
Figure 1.7:
Left: Sequence mutation model.
Transitions are are shown in black lines, transversion are
shown with dotted lines.
Right: The probability that a transition or transversion is occurring during some time.
The shown graph uses equal base frequencies, but the used model does not need this restriction.
|
|
We use a rather restrictive ascertainment
models for SNPs (Kuhner et al. 2000).
Currently there are two versions implemented.
If you want to use the SNP options, please contact me before
you run large scale analyses.
- We have
found ALL variable sites and use them even if there are only a few
members of another alleles present. In principal it is as you would
sequence a stretch of DNA and then remove the invariant sites.
Each stretch is treated as completely linked. You can combine many of
such ``loci'' to improve your estimates.
- SNP were developed from a panel population of which we know the
number of individuals, and that the markers developed were variable, but
we do not know the actual nucleotides for the individuals [Not fully tested].
This is certainly not how people develop SNPs, but currently the closest
we can come up with.
The SNP coding is otherwise exactly the same as the coding for DNA data.
If you want to assume that each SNP is unlinked then you need to
code each SNP like a sequence data locus with one nucleotide
(see the examples for sequences),
I have run successfully 50 SNP loci on a laptop with 40 MB of RAM.
But there may be better ways to run loci consisting of only one site.
If you want to know how to install or compile the program goto the sections
at the end of this manual.
This manual is in a transition phase until the two-population program migrate
and the
-population migrate-n are merged. The merger will happen once the n-population program is formally described in a peer-review journal.
Options only available with the 2-population version are
marked with (2-POP).
The data needs to be in a certain form; for us, the following format was most convenient.
Eventually we will include the NEXUS format (which is used in MacClade and Paup), but currently the NEXUS format is not able to keep all the data format
LAMARC allows.
Syntax: a token is either a word, a collection of words, or a character or a number:
the token between the the ``angle-brackets" is obligatory
-
in square brackets are optional.
-
are obligatory for some
-
choose one of the token
kind of data.
A range of numbers in a ``word" token as in
individual1 10-10
means that this token needs to be 10 characters long. The characters for
any word token can normally include special characters, punctuation, and blanks, the token for the individual name Ind1 02 @ is legal.
The most common data file for enzyme electrophoretic data or microsatellite data
would look like this (examples follow):
<Number of populations> <number of loci> {delimiter between alleles} [project title 0-79]
<Number of individuals> <title for population 0-79>
<Individual 1 10-10> <data>
<Individual 2 10-10> <data>
....
<Number of individuals> <title for population 0-79>
<Individuum 1 10-10> <data>
<Individuum 2 10-10> <data>
....
The delimiter is needed for microsatellite data and the project title is optional. The data
will be described in the following sections. The individual name has to be by default
10 characters (same as in PHYLIP), but can be changed to an other constant in the parmfile, even to a length of 0.
For sequences or SNPs, the syntax is slightly different, the following case
is for non-interleaved sequence data.
<Number of populations> <number of loci> [project title 0-79]
<number of sites for locus1> <number of sites for locus 2> ...
<Number of individuals> <title for population 0-79>
<Individuum 1 10-10> <data locus 1>
<Individuum 2 10-10> <data locus 1>
....
<Individuum 1 10-10> <data locus 2>
<Individuum 2 10-10> <data locus 2>
....
<Number of individuals> <title for population 0-79>
<Individuum 1 10-10> <data locus 1>
<Individuum 2 10-10> <data locus 1>
....
<Individuum 1 10-10> <data locus 2>
<Individuum 2 10-10> <data locus 2>
....
Interleaved sequence data:
<Number of populations> <number of loci> [project title 0-79]
<number of sites for locus1> <number of sites for locus 2> ...
<Number of individuals> <title for population 0-79>
<Individuum 1 10-10> <data locus 1 part 1>
<Individuum 2 10-10> <data locus 1 part 1>
....
<data ind1 locus 1 part 2>
<data ind2 locus 1 part 2>
....
<Individuum 1 10-10> <data locus 2>
<Individuum 2 10-10> <data locus 2>
....
<data ind1 locus 2 part 2>
<data ind2 locus 2 part 2>
....
etc.
The input for SNPs is the same as for sequence data.
The examples in this section look like real data, but they are only
for the demonstration of the syntax, if you try run this ``data''
it will deliver often very strange values, I have added a ``usable'' test set
of simulated data in the examples directory, see the file examples/README
for more information.
The data is given in genotypes, any printable character with ASCII
code bigger than 33 ('!') and smaller than 128 can be used. '?' is reserved for missing data. You can use multi-character coding when you use a delimiter (see the
examples for microsatellites).
If there is enough interest I can work on a input using
gene frequencies, although I prefer to work on more interesting things than adjusting input files.
Example with 2 populations and 11 loci and with 3 and 2 individuals per population,
respectively (this data set is only an example of syntax, analyzing this
dataset would not make much sense).
2 11 Migration rates between two Turkish frog populations
3 Akcapinar
PB1058 ee bb ab bb bb aa aa bb ?? cc aa
PB1059 ee bb ab bb bb aa aa bb bb cc aa
PB1060 ee bb b? bb ab aa aa bb bb cc aa
2 Ezine
PB16843 ee bb ab bb aa aa aa cc bb cc aa
PB16844 ee bb bb bb ab aa aa cc bb cc aa
The third argument on the first line has to be a delimiter character, for example a ``.".
The data is given in genotypes. Each individual has two alleles.
Alleles are coded as REPEAT NUMBERS, so for example your
sequence
Flanking msat Flanking
region region
--------============-------
ACCTATAGCACACACACACAAATGCGA
contains a microsatellite with 6 repeats. And if with a homozygote individual
it needs to be coded as 6.6, where the ``,'' is the delimiter.
'?' is reserved for missing data.
Example:
2 3 . Rana lessonae: Seeruecken versus Tal
2 Riedtli near G\"undelhart-H\"orhausen
0 42.45 37.31 18.18
0 42.45 37.33 18.16
4 Tal near Steckborn
1 43.46 33.37 18.18
1 44.46 33.35 19.18
1 44.46 35.? 18.18
1 43.42 35.31 20.18
After the individual name
follows the base sequence of that species, each character being one of the
letters A, B, C, D, G, H, K, M, N, O, R, S, T, U, V, W, X, Y, ?, or - . Blanks will be ignored, and so
will numerical digits. This allows GENEBANK and EMBL sequence entries to be
read with minimum editing. These characters can be either upper or lower case. The algorithms
convert all input characters to upper case (which is how they are treated).
The characters constitute the IUPAC (IUB) nucleic acid code plus some slight
extensions. They enable input of nucleic acid sequences taking full account of
any ambiguities in the sequence.
| Symbol |
Meaning |
|
| |
|
|
| A |
Adenine |
|
| G |
Guanine |
|
| C |
Cytosine |
|
| T |
Thymine |
|
| U |
Uracil |
|
| Y |
pYrimidine |
(C or T) |
| R |
puRine |
(A or G) |
| W |
"Weak" |
(A or T) |
| S |
"Strong" |
(C or G) |
| K |
"Keto" |
(T or G) |
| M |
"aMino" |
(C or A) |
| B |
not A |
(C or G or T) |
| D |
not C |
(A or G or T) |
| H |
not G |
(A or C or T) |
| V |
not T |
(A or C or G) |
| X,N,? |
unknown |
(A or C or G or T) |
| O |
deletion |
|
| - |
deletion |
|
Example with 2 population with 2 loci, the sequences are NOT interleaved:
2 2 Make believe data set using simulated data (2 loci)
50 46
3 hinders wiesli
eis ACACCCAACACGGCCCGCGGACAGGGGCTCGAGGGATCACTGACTGGCAC
zwo ACACAAAACACGGCCCGCGGACAGGGGCTCGAGGGGTCACTGAGTGGCAC
drue ATACCCAGCACGGCCGGCGGACAGGGGCTCGAGGGAGCACTGAGTGGAAC
eis ACGCGGCGCGCGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
zwo ACGCGGCGCGAGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
drue ACGCGGCGCGAGAACGAAGACCAAATCTTCTTGATCCCCAAGTGTC
2 vorders wiesli
vier CAGCGCGCGTATCGCCCCATGTGGTTCGGCCAAAGAATGGTAGAGCGGAG
fuef CAGCGCGAGTCTCGCCCCATGGGGTTAGGCCAAATAATGTTAGAGCGGCA
vier TCGACTAGATCTGCAGCACATACGAGGGTCATGCGTCCCAGATGTG
fuefLoc2 TCGACTAGATATGCAGCAAATACGAGGGGCATGCGTCCCAGATGTG
Same example with 2 population with 2 loci, but the sequences are now interleaved:
2 2 Make believe data set using simulated data (2 loci, interleaved)
50 46
3 hinders wiesli
eis ACACCCAACACGGCCCGCGGACA
zwo ACACAAAACACGGCCCGCGGACA
drue ATACCCAGCACGGCCGGCGGACA
GGGGCTCGAGGGATCACTGACTGGCAC
GGGGCTCGAGGGGTCACTGAGTGGCAC
GGGGCTCGAGGGAGCACTGAGTGGAAC
eis ACGCGGCGCGCGAACGAAGACCA
zwo ACGCGGCGCGAGAACGAAGACCA
drue ACGCGGCGCGAGAACGAAGACCA
AATCTTCTTGATCCCCAAGTGTC
AATCTTCTTGATCCCCAAGTGTC
AATCTTCTTGATCCCCAAGTGTC
2 vorders wiesli
vier CAGCGCGCGTATCGCCCCATGTGGTTCGGCCAAAGAATG
fuef CAGCGCGAGTCTCGCCCCATGGGGTTAGGCCAAATAATG
GTAGAGCGGAG
TTAGAGCGGCA
TCGACTAGATCTG CAGCACATAC
TCGACTAGATATG CAGCAAATAC
GAGGGTCATGCGTCCCAGATGTG
GAGGGGCATGCGTCCCAGATGTG
I tried to make it simple and redundant,
so that there are more than one way to set up things.
There a several special file names, some of them can be changed others not:
| Filename |
Type |
Description |
Needed? |
Name changeable |
| infile |
Input |
holds you data |
necessary |
* |
| parmfile |
Input |
holds options |
optional |
- |
| seedfile |
Input |
holds a random number seed |
optional |
- |
| catfile |
Input |
holds categories for mutation rate variation |
optional |
- |
| weightfile |
Input |
holds weights for each site |
optional |
- |
| outfile |
Output |
will be created and replace any file with the same name in the same directory |
necessary |
* |
| treefile |
Output |
holds genealogies, this file will be created and will replace any file with the same name in the same directory |
optional |
- |
| mathfile |
Output |
holds plot coordinates for the use in a mathematica notebook, this file will be created and will replace any file with the same name in the same directory |
optional |
* |
| sumfile |
Output |
holds the summary statistic of the sampled genealogies for further analysis, this file will be created and will replace any file with the same name in the same directory |
optional |
* |
| logfile |
Output |
logs the progress information that is displayed onto the screen into a file |
optional, this file will be created and will replace any file with the same name in the same directory |
* |
- infile if this file is not present in the current directory
than the program will ask for a data file, and you can
give the path to it, you need to type the path, which is for Macintosh and Windows users probably rather uncomfortable. In the menu or parmfile you can specify an other default name for your datafile.
- parmfile can hold specific menu options, this file and the possible options for the menu are explained in detail in section menu and parmfile.
- seedfile holds a random number seed, this is just present for compatibility with PHYLIP, the random number seed can be set in various
ways either in the menu or in the parmfile.
- catfile hold the categories, for each locus you must give
the number of categories, and the value of each category and then a string of
category assignments for each site. You can use the # as a commentary character.
# Example catfile for two loci with 40 and 30 bp each
#
2 1 10 1111111111111111111122222222222222222222
3 1 3 9 111111111122223333333333222222
- weightfile, for each site and locus you need to give a weight, acceptable weights are
integers from 0 - 9 and letters A-Z, A is the weight 10, B 11 and so on, in total
there are 35 possible different weights possible. You need a weight string for
each locus.
# Example weightfile for two loci with 40 and 30 bp each
#
1101101101101101101101101101101101101101
33F33F22F22F22F22F22FHHHHHHHHH
- outfile somewhere you want to read the results, that is it! The name outfile is the default, but can be changed either in the menu or the parmfile.
- treefile holds all, only those of the last chain or
the best tree(s). The likelihood of each tree is given (
) in a comment. The programs writes trees with migrations using the Newick format with extensions from the Nexus format, unfortunately I do not know yet a program who can print them nicely.
Writing trees to a treefile adds
some burden to the program and it will run slower, especially with the option BEST.
- mathfile holds the raw likelihood surface data, if this was requested in the options. The name mathfile is the default, but can be changed in the menu or parmfile (see appendix).
- sumfile holds the summaries of all genealogies, if this was requested in the parmfile or menu. The name sumfile is the default. His option allows
to reanalyze a previous run for likelihood ratio test or profiles.
If you have compiled and installed the program successfully (see Installation) and your data is in a good format (section data format) and perhaps has the name infile, just execute
| migrate-n |
for 1 to n populations |
Either by double clicking its icon (see on the title page) or for UNIX typing
its name in a shell.
Without any parmfile, Migrate will display a menu, in which you can change all the sensible options. For hints how to use the parmfile, look into section Menu and Options or the parmfile.doc. Once you know how to customize the options with the parmfile you will probably more often
edit the parmfile than making the changes in the menu.
You can change the options in the menu (Fig. 2.1) using letters or in submenus numbers.
In menu entry Data type you need to specify what kind of data you have and according
to that type some other menu entries appear, for example: t/t ratio for sequences.
Figure 2.1:
Top menu of Migrate
=============================================
MIGRATION RATE AND POPULATION SIZE ESTIMATION
using Markov Chain Monte Carlo simulation
=============================================
Version 0.9.6
Program started at Thu Jul 13 22:11:58 2000
Settings for this run:
D Data type
(currently set: microsatellite model)
I Input/Output formats
P Start values for the Parameters
S Search strategy
W Write a parmfile
Q Quit the program
Are the settings correct?
(Type Y or the letter for one to change)
|
|
Menu options can also be changed in the parmfile.
All possible options are shon parmfile syntax, but the same items can
be changed in the menu as well. All entries in the parmfile
are not case sensitive and all options
can be given with the first letter, e.g. datatype=Allele is equal to
datatype=A.
Although, I do not recommend being terse, because the parmfile
is rather hard to read.
If you chose D in the main menu then you see
DATATYPE AND DATA SPECIFIC OPTIONS
1 change Datatype (currently: DNA sequence model)
2 Transition/transversion ratio: 2.0000
3 Use empirical base frequencies? Yes
4 One category of sites? One category
5 One region of substitution rates? Yes
7 Sites weighted? No
8 Input sequences interleaved? No, sequential
0 Start genealogy is estimated using a UPGMA topology
Are the settings correct?
(Type Y or the number of the entry to change)
To change the data type select 1, the other numbers show
options that are relevant for the actual data type. There are several
datatypes such as the following:
datatype=
Allele
Microsatellites
Brownian
Sequences
Nucleotide-polymorphisms
Panel-SNP
Genealogies
specifies the datatype used for the analyses, needless to say
that if you have the wrong data for the chosen type the program
will crash and will produce sometimes very cryptic error messages.
- Allele: infinite allele model, suitable for electrophoretic
markers, perhaps the ``best'' guess for
codominant markers of which we do not know the mutation model.
- Microsatellite: a simple electrophoretic ladder model is
used for the change along the branches in genealogy.
- Brownian: a Brownian motion approximation to
the stepwise mutation
model for microsatellites us used (this is much faster
than exact model,
but is not a good approximation if population sizes
are small (say below 10).
- Sequences: Data are DNA or RNA sequences and the mutation model used is F84, first used by Felsenstein 1984 (actually the same
as in dnaml (Phylip version 3.5), a description of this model
can be found in Swofford et al. 1996.
- Nucleotide-polymorphism:[SNP] the data likelihood is corrected for
sampling only variable sites. We assume that the a sequence data set
was used to find the SNP. It is more efficient to run the full sequence
data set.
- Panel-SNP: the data likelihood is corrected for
using a panel of SNP sites, that were polymorphic. The panel has to be population 1.
- Genealogies: Reads the sumfile (see INPUT/OUTPUT section)
of a previous run, with this options the genealogy sampling step will not be done
and the genealogies provided in the sumfile are analyzed. This datatype
makes it easy to rerun the program for different likelihood ratio test or
different settings for the profile likelihood printouts.
If you specified datatype=Sequence the following options have some meaning and will show up in the menu (see also details for these options in the main.html and dnaml.html of the PHYLIP distribution
http://evolution.genetics.washington.edu/phylip.html)
- freq-from-data=
Yes
No:freqA freqG freqC freqT
- freq-from-data=Yes
calculates the base frequencies from the infile data, this will
crash the program if in your data a base is missing, e.g. you try
to input only transitions. The frequencies must add up at least to 0.9999.
- freq-from-data=No:0.2 0.2 0.3 0.3
Any arbitrary nucleotide frequency can be specified.
- ttratio=
r1 r2 .....
you need to specify a
transition/transversion ratio, you can give it for each locus in the
dataset, if you give fewer values than there are loci, the last
ttratio is used for the remaining loci
if you specify
just one ratio the same ttratio is used for all loci.
- interleaved=
Yes
No
If your data is interleaved you need to specify this here, the default is
interleaved=No.
- categories=
Yes
No
If you specify Yes you need a file named " catfile in the same directory
with the following Syntax:
number_of_categories cat1 cat2 cat3 .. categorylabel_for_each_site
for each locus, a # in the first column can be used to start a comment-line.
Example is for a data set with 2 loci and 20 base pairs each
# Example catfile for two loci
# in migrate you can use # as comments
2 1 10 11111111112222222222
5 0.1 2 5 23 3 11111122223333445555
- rates=
n : r1 r2 r3 ..rn
by specifying rates a hidden Markov model or rates is used for the sequences (Felsenstein and Churchill 1995), also see the PHYLIP documentation.
In the Menu you can specify rates that follow
a Gamma distribution,
with the shape parameter alpha of that Gamma distribution,
the program then calculates the rates and the rate probabilities ( prob-rates).
- prob-rates=
n : p1 p2 p3 ... pn
if you specify your own rates you need also to specify
the probability of occurrence for each rate.
- autocorrelation=
Yes:value
No
if you assume hat the sites are correlated along the sequence, specify the block size, by assuming that only neighboring nucleotides are affected you would
give a value=2.
- weights=
Yes
No
If you specify Yes you need a file weightfile with weights for each
site, the weights can be the following numbers 0-9 and letters A-Z,
so you have 35 possible weights available.
# Example weightfile for two loci
11111111112222222222
1111112222AAAA445XXXX5
- distfile=
Yes
No
You can supply a distance file for each locus (using PHYLIP syntax).
Each individual must have is own name.
This option appears in the menu when you choose
0 Start genealogy is estimated using a UPGMA topology
The distance file is then used to create an UPGMA tree with a minimal number of migration events. For large trees this is options help to get
better starting trees than the automatic tree generation which uses
a rather unsophisticated distance method (differences).
- usertree=
Yes
No
If you specify Yes you need a file intree. In this file you have
starting trees for each locus, BUT these trees need to have
migration events in them, currently only Migrate can write trees with
migration events on it, if you inspect such a file you can see, how
such a intree file is organized and could insert migration events
by hand. If you need this options, please contact me at
beerli@genetics.washington.edu
- randomtree=
Yes
No
Generates a random starting tree with ``coalescent time intervals'' accoring to the start parameters. This is generally a bad choice, but in conjunction of many short chains and the replicate=YES:number option
[number is bigger than 1, see below]. This can help to search the
parameter space more efficiently.
If the datatype=Microsatellite is used, the following options have some meaning, please remark that if you use the Brownian motion option these
restriction do not apply.
- micro-max=value
specifies the maximal allowed number of repeats, this MUST be higher
than your actual maximal repeat number in your dataset,
if it is too high there is a penalty only on allocating to much space
and perhaps in slight runtime degradation (the empty space has to be copied),
but if it is too small your results will be wrong!
The default is set to micro-max=200.
- micro-threshold=value
specifies the window in which probabilities of change are calculated
if we have allele 34 then only probabilities of a change from 34 to 35-44
and 24-34 are considered, the probability distribution is visualized in Figure 1.6 the higher this value is the longer you wait for your result, choosing it too small will produce wrong results. If you get
-Infinity during runs of migrate then you need to check that
all alleles have at least 1 neighbor fewer than 10 steps apart.
If you have say alleles 8,9,11 and 35,36,39 then the default will
produce a probability to reach 11 from 35 and as a result the
likelihood of a genealogy will be -Infinity because we multiply over
all different allele probabilities.
Default is micro-threshold=10
No special variables, but see Parmfile specific commands.
Similar to sequence data.
This group of options specifies input file names and various output file options. Also, titles for the analysis can be specified. In addition, one can tailor the information the program is presenting during
the execution. Some of the options in this manual are currently not implemented
in the two population program ( migrate-0.4, Beerli and Felsenstein 1999),
the n-population version which will eventually replace the two-population version will contain all the mentioned options.
Figure 2.2:
Input/Output menu of Migrate
INPUT FORMATS
-------------
1 Datafile name is infile
2 Use automatic seed for randomisation? Yes
3 Title of the analysis is <no title given>
OUTPUT FORMATS
--------------
5 Print indications of progress of run? Verbose
6 Print the data? No
7 Outputfile name is outfile
8 Plot likelihood surface? No
9 Profile-likelihood? Yes, tables and summary
[Percentiles using exact Bisection method]
10 Likelihood-Ratio tests? No
11 Print genealogies? None
12 Plot coordinates are saved in mathfile
13 Summary of genealogies will not be saved
14 Save logging information? No
Are the settings correct?
(type Y to go back to the main menu or the letter for the entry to change)
|
|
- infile=filename
If you insist to have a datafile names other than infile, you can change
this here, if you do not specify anything here, it will use any file
with name infile present in the execution directory, if there is no
infile than the program will ask for the datafile and
you can specify the path to it (this may be hard on Macs and Wintel machines).
If you use this option, do NOT use spaces or ``/'' or on Macs ``:''
in your filename. The default is obviously infile=infile
- random-seed=
Auto
Noauto
Own:seedvalue
The random number seed guarantees that you can reproduce a run
exactly. I you do not specify the random number seed ( seed=Auto)
the program will use the system clock. With seed=Noauto the program expects to find a file named seedfile with the random number seed.
With random-seed=Own:seedvalue you can specify the seed value in the parmfile
(or in the menu).
Example for own seed:
random-seed=Own:21465
If you want reproducible runs you should replace the Auto seed with your own starting number (best numbers are divisible by 4 + 1)
The default is random-seed=Auto. I personally use
always random-seed=Own:seedvalue. But then you need to change this for different run,
otherwise the sequence of random numbers is always the same.
- title=titletext
if you wish to add an informative title to your analysis,
you can do it here or in the infile, the infile will override
the title specified here. The length of the title is maximal 80 characters.
Example: title=Migration parameter estimation of populations A and B of species X.
- progress=
Yes
No
Verbose
Show intermediate results and other hints that the program is running.
Prints time stamps and gives a prognosis when the program eventually
will finish, but this is a rather rough guide and sometimes gets fooled.
An analogy, the system knows ahow far to drive and how far we have
already driven and the time, but no clue about how many speed bumps
(many migration events) and accidents are ahead of us.
Verbose adds more hints (at least for me) and information.
The default is progress=Yes
- outfile=filename
All output is directed into this file, the default name is outfile. If you use this option, do NOT use spaces or ``/'' or on Macs ``:'' in the filename.
The default is obviously outfile=outfile
- print-data=
Yes
No
Print the data in the outfile. defaults is print-data=No.
- print-fst=
Yes
No
Print a table of an
estimate for comparison (Beerli and Felsenstein 1999, Beerli 1998) [not recommended].
- plot=
No
Yes
[:
Outfile
Both
[:
std
log
:{mig-axis-start,mig-axis-end,theta-axis-start,theta-axis-end}
:printpos
M
Nm
]]
if plot=No then no plot of the parameter space is shown in the outfile,
if Yes then you can specify whether you want to have the accurate numbers
in a separate file ( mathfile) using printpos ``pixel'' in each direction,or only the ASCII-graphics plot in the outfile. The last option (M or N)let you define wether you want the plot in
or (default)
.
Default is plot=Yes:Outfile, Example of a more complicated statement:
plot=Yes:Both:std:0,10,0,0.025:100N
After a run mathfile will contain the following
- 2-pop
- locus1=((x11,x12,...,x1n),(x21,..x2n),...,(xn1,..xnn)); locus2=...
the combination of all estimates is the last locus = locus(n+1)
the syntax of this file is so that you can import it directly into
Mathematica by using

mathfile (see in the example directory of this distribution for more material on this issue).
The default is plot=Yes which is equivalent to plot=Yes:Both.
- n-pop
- The mathfile will print only all summed up emmigration and immigration from/into a population, and the format changed to printing
only raw numbers: there are printpos
printpos cells for each plot (default for printpos is 36), so
for 2 loci and and 3 populations you get a total of 1552 numbers,
you can read these into mathematica using
rows=cols=36;
pop=3;
data=ReadList[``mathfile'',Table[Table[Table[Table[Number, {cols}], {rows}],
{2}],{pop}];
loci=Length[data];
(* now you can do something like the following after having filled in the
xstart, xend etc, looking it up in the outfile *)
ListContourPlot[data[[1,1]]-Max[data[[1,1]],
MeshRange->xstart,xend,ystart,yend,
Contours->0,-1,-2,-3,-4]
- profile=
No
Yes
:
Fast
Percentile
Discrete
Quick
M
Nm
Print profile likelihood. See section Likelihood ratio tests and profile likelihood. Default is profile=Yes:Percentile:N.
- No: No profile likelihoods are evaluated.
- Yes, All: Evaluate profile likelihoods and print tables for each parameter and also a summary table with the approximative percentiles for each variable.
- Percentile evaluates the profiles at the percentiles
(0.005, 0.025, 0.05, 0.25, 0.50, 0.75, 0.95, 0.975, 0.995).
This will need a LOT of time because
it has to find the percentiles by evaluating a full maximization
for n-1 parameters each
- Quick [means quick and dirty] Evaluates the profiled parameter
assuming that the parameters (
and
are uncorrelated.
This is equal to fixing all parameter
at the maximum likelihood and evaulate the likelihood for the profiled parameters. This
is very fast and often rather close to the Percentile option.
- Fast A mixture of Quick and Percentile. This is the default.
The percentiles are found using Quick and then one final full maximization of all other
parameters is done.
- Discrete Evaluate the profile likelihood at specific points which are
ML-estimate
(0.02, 0.10, 0.20, 0.5, 1, 2, 5, 10, 50).
- M or N The profiles are evaluated using
and
,
with the option N (the default) the migration values are printed as
(for most data this is
, but for mtDNA this could mean
it is
). With M the
are printed instead of the
.
- l-ratio=
None
Mean
Loci
:testparam
Likelihood ratio tests. See section Likelihood ratio tests and profile likelihood. Default is l-ratio=None.
- print-trees=
All
None
Last
Best
print genealogies into treefile. Remember these trees contain
migration events, although I followed the NEXUS rules (Maddison 1998)
and the migration events are in comment brackets,
I do not know of any program being able to read this kind of trees.
I would like to hear from you if you know any other program who can
read and display such a tree.
- None: treefile is not initialized and no trees are printed,
this is the fastest and the one I recommend.
- All: will print all trees (you want to do that only for ridiculously small datasets with too short chains or you have Gigabytes of free storage).
- Last: Only the trees of the last long chain are printed,
Still you will need lots of space.
- Best: Prints the tree with the highest data-likelihood for each locus.
This is slow! And give not very much information, except if you are more interested in the best tree than in the best parameter estimate.
Default is print-trees=None
- mathfile=filename
the plotcoordinates are directed into this file.
If you use this option, do NOT use spaces or ``/'' or on Macs ``:''
The default is obviously mathfile=mathfile.
- sumfile=
No
Yes
Yes:filename
Intermediate results of the genealogy sampling process are save into a file
named sumfile or into the file for that you specify the filename.
You can use this sumfile to rerun the program for further analysis,
e.g. calculating likelihood ratios or profile likelihoods, see datatype=Genealogy.
Figure 2.3:
`Start value for the parameter' menu of Migrate
START VALUES FOR PARAMETERS
---------------------------
1 Use a simple estimate of theta as start?
Estimate with FST (Fw/Fb) measure
2 Use a simple estimate of migration rate as start?
Estimate with FST (Fw/Fb) measure
3 Mutation rate is constant? Yes
FST-CALCULATION (for start value)
----------------------------------
4 Variable Theta, M symmetric
MIGRATION MODEL
---------------
5 Model is set to Full migration matrix model
Are the settings correct?
(Type Y to go back to the main menu or the letter for an entry to change)
|
|
- theta=
Fst
Own:value1,value2
With Fst the programs tries to use an F
based measure
(Maynard Smith 1970, Nei and Feldman 1972)
for the estimation of
and
which are the 4
effective population size
mutation rate for each population.
Own: value1, value2 defines arbitrary start values.
The default is theta=Own:1.0,1.0, which is inapproriate for sequence
data where values around 0.01 are more common.
- migration=
Fst
Own:value1,value2
(2-POP)
With Fst the programs tries to use an F
based measure
(Maynard Smith 1970, Nei and Feldman 1972, Beerli 1998, Beerli and Felsenstein 1999)
for the estimation of
and
.
The values for Own are given in terms of
which is 4
effective population size
migration rate per generation.
The default is migration=FST
- migration=
Fst
Own:Migration matrix
The migration matrix is a
by
table with - on the diagonal and can look
like this for four populations
migration=OWN:{ - 1.0 1.1 1.2 0.9 - 0.8 0.7 2.1 2.2 - 2.3 1.4 1.5 1.6 - }
or like this
migration=OWN:{ - 1.0 1.1 1.2
0.9 - 0.8 0.7
2.1 2.2 - 2.3
1.4 1.5 1.6 - }
- mutation=
Gamma
NoGamma
If there are more than one locus the program summarizes over all loci.
The Gamma flag allows for the variation
of the mutation rate of each locus according to a Gamma distribution with
shape parameter
(alpha) (which is the inverse of the square of the
coefficient of variation (CV) of the mutation rate,
CV=standard deviation / mean). This is computationally daunting mostly for numerical reasons:
the program is maximizing a product of integrals over all possible mutation rates for each locus likelihood.
With Nogamma the summarizing step is simply finding the
best parameters by maximizing the sum of the log-likelihoods of each locus.
The default is mutation=Nogamma
Migrate is using the
calculation only to generate
starting values for the MCMC runs, when you did not wnat to give your guess-values for the parameters.
With two population and one locus we can only calculate 3 quantities from
the data for
: the homozygosity within each population and between them. Therefore we only can estimate 3 parameters, either both populations
have the same size and different migration rates or the sizes can be different, but the migration rates are the same.
fst-type=
Theta
Migration
- fst-type=Theta
for each population is variable, and the migration rate is fixed.
- fst-type=Migration
Migration rate for each population is variable, and
is fixed.
If the number of populations in the program is bigger than 2
only the option fst-type=Theta is available. All pairwise Theta estimates are averaged.
If you do not specify anything the joint maximum likelihood
estimate of all
parameters are found.
custom-migration=
The migration matrix contains the migration rates from population
j to i on row i, and the
are on the diagonal.
The migration matrix can consist of connections that are
- 0: not estimated
- m: mean value of either
or
.
- s: symmetric migration
- c: constant value (toghether with migration=OWN..
or theta=OWN..) [does not work yet]
- *: no restriction
The values can be spaced by blanks, newlines
A few examples for 4 populations:
Full model: custom-migration={****
****
****
****}
N-island model: custom-migration={m m m m
mm mm
m mmm
mmmm}
Stepping Stone model with symmetric migrations,
and unrestricted
estimates:
custom-migration={*s00 s*s0 0s*s 00s*}
Source-Sink (the first population is the source):
custom-migration={*000**000**0*000}
Figure 2.4:
`Search strategy' menu of Migrate
SEARCH STRATEGY
1 Number of short chains to run? 10
2 Short sampling increment? 20
3 Number of recorded genealogies in short chain? 500
4 Number of long chains to run? 3
5 Long sampling increment? 20
6 Number of recorded genealogies in long chain? 5000
7 Number of genealogies to discard [Burn-in] 10000
8 Combine chains for estimates? No
9 Heating: No
------------------------------------------------------------
Obscure options (consult the documentation on these)
10 Sample at least a fraction of new genealogies? No
11 Epsilon of parameter likelihood 100.00
12 Use Gelman's convergence criterium? No
Are the settings correct?
(Type Y to go back to the main menu or the letter for an entry to change)
|
|
This section is the key to good results and you should not just use the defaults, for guidance how I would do this see in the section how long to run.
The terminology of short or long chains is arbitrary, actually
you could choose values so that short chains are longer than the ``long''
chains. Anyway, Markov chain Monte Carlo (MCMC) approaches tend
to give better results when the start parameters are close to the maximum
likelihood values. One way to achieve this is running several short chains
and use the result of the last chain as starting value for the new chain.
This should produce better and better starting values,
if the short chains are not too short.
- Number of short chains to run? (short-chains=value
we run most of the time about 10 short chains, which is enough if the
starting parameters are not too bad. Default is short-chains=10.
- Short sampling increment? (short-inc=value)
The sampled genalogies are correlated to reduce the correlation between genealogies and to allow for a wider search of the genealogy space (better mixing), we sample not every genealogy, the default is short-inc=20
means that we sample a genealogy and step through the next 19 and sample then
again.
- Number of steps along short chains? (short-steps=value)
The default number of genealogies to sample for short chains is about 200.
But this may be to few genealogies for your problem. If you big data sets it
needs normally bigger samples or higher increments
to move around in the genealogy space.
- Number of long chains to run? (short-chains=value
we run most of the time 2 long chains. The first equlibibrates and the last
is the one we use to estimate the parameters. Default is long-chains=2.
- Long sampling increment? (long-inc=value)
The default is the same as for short chains.
- Number of steps along long chains? (long-steps=value)
The default number of genealogies to sample for long chains is about 2000.
I often choose the ``long'' chains about 10 times longer than the ``short`` chains.
- Number of genealogies to discard at the beginning of each chain?
(burn-in=value)
Each chain
inherits the last genealogy of the last run, which was created with the old parameter set. Therefore the first few genealogies are biased towards the old parameter set. When burn-in is bigger than 0, the first few genealogies
in each chain are discarded.
The default is burn-in=10000.
- Combine chains for estimates
The use of this option is recommended for difficult (many)
data sets. It allows to combine multiple chains for the parameter
estimates when you use replicate=YES:LongChains.
With replicate=YES:number where number is, well,
a number bigger than 1. (e.g. replicate=Yes:5), you run the program ``number'' times and the results of their last chains are combined,
The method of combination of chains is the same as in Kuhner et al. (1995)
and is based on Geyer (1991). The LongChain option does not need much more time than the single chain option, but the full replication needs
exactly ``number'' times a normal run. But is sampling the search space
much better than any other option, I use this often in conjunction with
random starting trees (randomtree=YES).
- Heating ( heating=<NO|YES<:{cold,warm,hot,boil}>
I have replaced the (broken) old scheme with a simpler one that should
work. It is based on the work of Geyer and Thompson (1991) and uses for
four chains at different temperatures, the hotter chains move more freely
and so can explore other genealogies, this allows for an efficient
exploration of data that could fit different genealogies, and should help
to set the confidence intervals more right that a single chain path
could do. You can set the temperatures yourself. The default
temperatures are {1,2,3,4}. The temperatures are ordered
from cold to boiling, the coldest temperature MUST be 1 (one).
The default for the heating option is heating=NO. If you use
this option sampling will be 4 times slower, except
if you have a multiprocessor machine.
Then you can compile the program using ``make thread'' this could
improve speed considerably.
If you are not experienced with MCMC or run Migrate for the first,
second, ... time, do not bother about the options here.
- Sample at least a fraction of new genealogies? ( moving-steps=
Yes:ratio
No
)
With some data the acceptance ratio is very low, for example with
sequence data with more than 5000 bp the accpetance ratio drops below 10%
and one should increase the length of the chains. One can do this either by increasing the long-inc, or long-steps or by using
moving-steps. The ratio means that at least that ratio of genealogies
specified in long-steps have to be new genealogies and if that fraction
is not yet reached the sampler keeps on sampling trees. In unfortunate situation this can go on for a rather long period of time.
You should always try first with the default moving-steps=No.
An example:
You specified long-steps=2000,and long-inc=20 and the acceptance-ratio was only 0.02, you have visited 40,000 genealogies of which only 800 are new genealogies so that you have maximally sampled 800 different
genealogies for the paramter estimation.
In a new run you can try moving-steps=Yes:0.1, the sampler is now extending the sampling beyond the 40000 genealogies and finally stopping when
4000 new genealogies were visited.
- Epsilon of parameter likelihood (long-chain-epsilon=value)
The likelihood values are ratios
 |
(Beerli and Felsenstein, 1999) |
|
When the Likelihood values are very similar then the ratio will be close
to 1, or 0 when we use logarithms. This means that the sampler
is not improving drastically between chains: (a) it found the maximum likelihood estimate or (b) it is so far from the maximum likelihood estimate that the surface is so flat that all likelihood values are equally bad.
using a smaller value than the default long-chain-epsilon=100.00
for example a value of 1.0 would guarantee that the sampler keeps on
sampling new long chains as long as that log-likelihood-difference drops below 1.0. In some cases this will never happen and the program will not stop.
- Gelman's convergence criterium If you specify ``Yes'' then
the number of last chains get extended until the convergence criterium
of Gelman is satisfied (the ratio has to be smaller than 1.2 for all parameters. This can take a very long time.
- menu=
Yes
No
defines if the program should show up the menu or not.
The default is menu=Yes.
- end
Tells the parmfile reader that it is at the end of the parmfile.
THIS IS NEEDED!
If you change these, you should understand why you want to do this.
- nmlength=number
defines the maximal length of the name of an individuum, if for a strange
reason you need longer names than 10 characters (e.g. you need more than
10 chars to characterize an individual) and you do not need this
very often then set it to a higher value, if you have no individual names
you can set this to zero (0) and no Individual names are read.
the default is nmlength=10, this is the same as in PHYLIP.
- popnmlength=number
Is the length of the name for the population.
The default is popnmlength=100
- allelenmlength=number
This is only used in the infinite allele case.
Length of an allele name, the default should cover even strange
lab-jargons like Rvf or sahss (Rana ridibunda very fast, Rana saharica super slow)
The default is allelenmlength=6
The parameter estimation is done with a maximum likelihood method,
this gives the
opportunity to easily test different hypotheses against others, when the hypotheses are hierarchical (e.g. Casella and Berger 1996). For example,
we wish to test that the migration rates are the same
in a two population model with 4 parameters:
In the example the degrees of freedom would be two: we are
changing two parameters.
We need to run migrate with the full model: all parameter can vary
independently. We get parameter estimates
,
,
, and
. We compare this maximum likelihood
with the likelihood when we restrict the migration rate to be the same
for example the mean of both estimates. The ratio between these two likelihoods
is in the limit (if there is a huge amount of data)
distributed
(Formula 2.3, Figure 2.5).
If the probability is smaller than
we would reject the
Null-hypothesis and accept the alternative, saying that the values
are not equal.
If you have mtDNA data this methods is theoretically not applicable, because
you cannot increase the data beyond the full sequence of the mitochondrion,
but I am pretty sure that for most situations the test will be
still appropriate.
There is a problem due to the implementation of the program that we can
not allow that parameters go to 0.0. A parameter of 0.0 has a 0.0 probability. Tests against 0.0 need a halfed significance level, because we truncate at
0.0, and therefore are testing only one-sided (...cit...).
Figure 2.5:
Likelihood ratio test: dashed areas are outside of the 95% confidence limit.
is
;
,
|
|
Do not forget that these likelihoods are only
approximations. Comparison with exact likelihoods for
genealogies with 3 tips and no migration show that the MCMC curves are
exactly the same as the ``exact'' curves. When the program is not run long
enough the MCMC curves tend to be wider than the ``exact'' curves and
have their maximum biased towards the parameter value at which we run the chains. We expect
when there are many sampled individuals that it is likely that you
run the program not long enough and therefore will get wrong confidence
interval estimates and will stick too close to the start parameters.
(Figure 2.6).
You can check for this by running the program several
times from very different start values. Just looking at the point estimates,
is probably not enough, you need to inspect the profile likelihoods too.
Most of the time it seems that real single locus data is not very great for
the estimation of migration rates and the ``confidence'' intervals are huge.
Figure:
Log likelihood curves from (a) the exact likelihood
calculation for a genealogy with 3 samples, (b) an MCMC based estimator
with only one (1) sampled genealogy with start value
Watterson estimate,
(c) with one acceptance using a
. The data are 3 sequences each
1000 bp long and generated with a
, running the program some 1000
genealogies delivers a likelihood curve indistinguishable from the exact likelihood curve.
|
|
For the parmfile there is an option l-ratio which you can use to
define a hypothesis against the program run (Null-hypothesis).
You can repeat the statement for testing more than one hypothesis,
but you may need to correct your significance level for multiple tests.
The syntax is:
l-ratio:
Means
Loci
:param1,param2,param3,....paramn*n
- Means over all loci
- loci for each locus, this may not be valid for sequences,
the likelihood ratio test assumes convergence if the sample size
goes to infinity, but with a finite sites model and one locus this can
not be achieved, so the the
statistic may not be appropriate.
The syntax for each param1, param2,... is rather complicated:
param1 =
*
x
m
value
- * the value is the same as the one from the estimate (
)
- x the value will be maximized.
- m the value is the mean of the parameters, either
or
.
- value is any arbitrary value you want to test against the
.
Examples for two populations for the parmfile entries:
l-ration=Means:0.01,0.011,1.0,1.1;
l-ratio=Means:*,*,m,m;
l-ratio=Means:x,m,*,0;
The parameters are ordered according to the following rule:
,
, ...,
,
,
, ...,
,
,
, ...,
, ...,
Although you specify
the program evaluates
for the test and prints
. This seems more accurate, then the parameters
and
are uncorrelated.
Example with 3 populations based on the following migration matrix:
results in the string
l-ratio=Loci:*,*,*,2,1,1.8,1,0.5,0.6;
Do not forget the semicolon, the current program is picky and needs it
Parameter estimation in high dimensions causes serious problems
in the presentation of results: for 2 population we have 4 parameters,
with 8 population 64, etc. One would like to show the high dimensional surface
but we are crudely limited to 3 and perhaps can understand graphs up to five.
Showing one parameter at a time only shows us a transection through the solution space, but is perhaps the best we can do. By using profile likelihoods
we can trace a parameter and also see how the other parameter change at given
values for our profile parameter. Instead of finding the parameters at the maximum likelihood, we fix the profile parameter at some arbitrary value and then maximize the other parameters at that profile likelihood. This constructs a path through the solution space, which we can use to construct approximate confidence limits
using the likelihood ratio test criteria (Fig 2.7) with a degree of freedom of 1 (well, this is true in ``asymptopia''
but may produce very tight confidence intervals (see Beerli and Felsenstein 2000). Several advanced statistic textbooks discuss the use of likelihood ratio and
the related profile likelihoods (e.g. Casella 1996), but I like the compact,
and in my opinion, very readable, short text of Meeker and Escobar (1995).
Figure 2.7:
Profile likelihood, for a series of values of a parameter, the other parameter are maximized and the likelihood given that parameter is highest along the straight lines in A. (A) Contour plots for a run with two variables,
the thick lines are the 50%, 95%, and 99% confidence contours. (B) is the
profile likelihood curve for
and (C) is the profile likelihood curve
for 4Nm (based on
). The 95% confidence range for B and C are for values
with log likelihood values above -2.
|
|
The program will show additional information if the progress flag is set ( progress=Yes is the default). You can even see more with progress=verbose. With logfile=filename
all progress is also directed into this logfile, the default name is
logfile.
The progress is report similar to the following screen dump fragment
for each chain and each locus. I added a line number which is not part of
the output (Y means standard progress report, V are the additional lines in verbose mode).
01Y 11:49:01 Start conditions: theta={811.90959,0.03487}, M={140.99436,0.00000},
02Y Start-tree-log(L)=-93.678120
03Y 11:49:01 Equilibrate tree (first 200 trees are not used)
04Y 11:49:03 Long chain 1: lnL=0.21525 ,
05Y theta={0.04026,0.05527}, M={83.96647,45.78351}
06V Sampled tree-log(L)={-98.760356 .. -93.035062}, best in group =-93.019453
07V log(P(g|Param)) -20 to -18 -16 -14 -12 -10 -8 -6 -4 -2 0 All
08V Counts 0 0 0 0 0 0 0 0 144 56 200
09V Maximization steps needed: 134
10V Coalescent nodes: 0 1 2 3
11V population 0: * - - -
12V population 1: - - - *
13Y Acceptance-ratio = 1095/2000 (0.547500)
.....
14Y 11:49:09 Final parameter estimation over all loci
15Y
16Y <paste in correct part>
17Y
18Y 11:49:09 Program finished
The values reported should give some hints how the program progresses
through the sample space. The tree likelihoods (line 06V) should go
steadily up until a peak in the likelihood surface has been reached.
It can go down through a valley of bad values and either recover on the
same peak or another one. If this process runs long enough it is
guaranteed that it will find the global maximum. But the program is not
searching the tree-likelihood maximum, it searches through the space
defined by
and its maximum is not necessarily at the highest tree likelihood.
The ``histogram" (07V, 08V) of the
reflects this.
The histogram is scaled so that the best value is 0.
If most of the values are in the topmost class the estimate is
probably in good accordance with the trees, otherwise the process
should run longer. Of course if all genealogies are in the topmost
class one could wonder if the process is sampling different trees at
all, but this can be checked with the acceptance ratio. If the
Acceptance ratio (13Y) drops below 10% consider to run the program
with ten time longer chains just to sample enough different
genealogies, so that the parameter estimates are not governed by a few
genealogies only.
If the single locus maximization step needs
more than 200 iterations (09V), please send a report, then it should
find most of the time the maximum in fewer than 50 iterations.
If you have chosen to discard the first few trees using
burn-in=value, you will see line (3Y).
If you have looked in the menu Search Strategy then you saw that
we distinguish between short and long chains. Since the MCMC process
is going from a not so good estimate (the first guess, you specify in
Start values for Parameters) to a better estimate along a
``gradient'' on the likelihood surface, the success in recovering the
best parameters is driven by the steepness of this surface. This means
if there is few information in the data, the likelihood surface will
be flat and the estimation process need a long time to wander to a
peak (if at all) . The short chains allow for a burn-in period in
which the the trees and the parameters can equilibrate, for the final
estimate we use only the last of the long chains. The necessary length
of these chains is specified by the number of individuals, length of
sequences and variability of the data. There are no good estimates
what a good length for the final chains should be
For Migrate it seems that in simulated datasets with around 20
individuals and 10 ``electrophoretic'' loci the truth can be
recovered.
During my simulations for the paper on Migrate (Beerli and Felsenstein 1999), I detected problems
with the accurate estimation of the migration rate with
start to be obvious with very long sequences (say above 1000bp).
The first tree is constructed using an UPGMA topology and a Fitch algorithm to
insert the migrations. This process will insert a minimum of migrations
onto the tree.
If now the sequences define a good topology for your guessed start
parameters the program will tend to be stuck with this starting tree. This is
fine for estimating the population size, but the migrations are not
well distributed on the tree.
I recommend that you run longer chains and watch the
acceptance-rejection, if the program finds about 200 new trees for short chains and about 2000 trees for long chains or more then the estimation process should be fine.
If in your initial run you see acceptance ratios of only around 2% you should
definitely increase the length of the chains, or use the option moving-steps.
When after some runs
you see that the program returns hugely different values, for example
the profile likelihood curves exclude the parameter estimates of other
runs, you should also consider running multiple chains
at different temperatures or use replication (see Search Strategy).
Most likely, there are
sets of genealogies that are not that well connected and with short
chains the program will settle in one solution.
Currently there is no way to check
which of the independent runs fits the data better because the
reported likelihoods are relative and not absolute and this makes
it impossible to compare different runs.
Of course this is not a fool proof guide, then it's easy to give advice with
data simulated using the same sequence model as the inference program.
FIRST: make sure that your data is correct. Miscounts of individuals,
sequence length, number of loci etc can produce funny errors.
- Set parameters in the Search Options to very low values,
e.g to something
below 100 for sampling increment and the chains to something like 2, also
Turn off the profile and plot option, but set print the data
in the Input/Output menu.
- run the program an check if the number of individuals read is correct,
and if all the data was read, and if the program produces numbers
in the output. If the program crashes before the menu there is an error
in the parmfile, if it crashes shortly after the menu most likely
there is some error in
the infile. If it crashes at the end, most likely there is a programmer's
bug :-(.
- Once it is clear that the program is able to run, use the default options
to start a first run. If you have written a parmfile you should rename
or destroy it.
Monitor the progress by looking at the intermediate parameter estimates:
- Check the log on the screen or the logfile, if the data-likelihood of
the start tree for each chain is always improving then consider to lengthen
the increment between the sampled genealogies (e.g. short-inc=100) or
supply
your own distance matrix ( distfile option), or give own starting
values or run more short chains (e.g. short-chain=20).
- Gelman's convergence criterium: My implementation of this criteria
is not completely correct, then migrate is using two consecutive chains
to calculate the criterium, whereas Gelman used chains with ``overdispersed''
starting points. If the values are close to 1 (Gelman uses
) then
we can assume that the chains are sampling from the stationary distribution
and that our parameter estimates are OK, but of course this is no guarantee
then if the sampler is sampling onwly around one probability mountain and
does not know that another much higher mountain exist, the results will be wrong.
But, besides monitoring progress, I would:
- Run Migrate with the default values using
to find
the start parameters.
- Rerun, using the obtained parameter estimates of the last run.
- If the results do not change much , perhaps you can stop. Otherwise
increase the length of the chains, increasing the increment
(e.g. short-inc=100 and long-inc does not
increase memory usage, but run-time.
You can also increase the number of sampled
genealogies ( short-sample or long-sample).
E. g. increase it by a factor of 10.
- Change the random number seed and check if you get similar results.
- Use the heating scheme if you get wildly different results and
have low acceptance ratios.
- Run with replicates=YES:10 and perhaps also using
randomtree=YES, but beware this will run 10x longer then your single
run.
- Microsatellite and Electrophoretic data should experiment with
lowering the number of sampled genealogies (if they have many loci), because
otherwise the runs will take forever, I am thinking of implementing
a parallel processing machinery (based on MPI) that would distribute the loci
onto different machines.
The run time and the memory usage of migrate is
highly dependent on the number of populations,
the length of the chains, and the number of loci.
It is common that a single locus data set can run for many hours even
very fast machines, resulting in runs of many days for
multilocus data sets. For some users this can produce a problem,
either the system administrator or other users gets mad about you
consuming ``all'' resources, this is mostly CPU and for large data
sets also memory.
For UNIX systems the immediate, but perhaps wrong,
answer to this people is that these demanding programs are one
of the reasons to use these fast computers;
a run of migrate does normally not compromise
any editing, mail reading, word processing on shared machines.
To free a terminal you can put migrate into background and log out.
- Run migrate-n
- Change the menu as you think is apropriate.
- In the main menu use (W)rite a parmfile.
- Kill the program (Control-c) or use (Q)uit.
- Edit the parmfile and change the entry menu=YES
to menu=NO and any other option you want to change.
If you intend to run the program several times you should change
for each run the random-seed=OWN:somenumber.
- Rerun the program with
nohup (nice migrate-n > migrate.log ; date |
mail -s ``migrate finished'' youremailaddress) &
the nohup allows you to logout without stopping the program,
additionally potential output is logged into nohup.out.
The nice causes to program to run slower when other users are
using the machine ``unniced''. On servers the nicing often happens
automatically after some time or they have a specific batch system,
ask you system administrator what's
best for a long run.
- logout or do something else, you will get mail when
migrate has finished, if you are curious and want to known when approximately it will finish peek into the file migrate.log, but do not save it.
For Windows and especially Macintosh systems the program is
unfortunately not a so good citizen and is disturbing other programs.
To run long migrate on these machines the best way is
to run this on a private machines, where you have the control.
Contents of the output in outfile: Some of the output options vary
according to the datatype. + = always present, o = optional, Default =
| Item |
Description |
Status |
| List of options |
all used options are specified |
+ |
| Summary of data |
(Too) short data summary |
+ |
| Dataset |
Print of the dataset |
o |
| MCMC estimates |
List of the estimated parameters for each locus and the mean |
+ |
Shape  |
Estimation of the shape parameters for the variation of the mutation rate |
o |
table |
Table of the possible start values generated with a
estimator |
o |
| plots |
plot of the likelihood surface in outfile |
o |
| |
plot of the likelihood surface into mathfile |
o |
-histogram |
Table of shape values versus log(likelihood), is varying whereas the other parameters are held constant at the maximum of the surface. |
o |
| Profiles |
Profile likelihood tables |
o |
| Percentiles |
Percentiles table, summary of profile tables |
o |
The
calculations are based on mean differences in populations compared
to mean differences between populations, for more information you should consult Maynard Smith (1970) and Hudson et al. (1989).
In the Appendix you can find a sample outfile with some comments.
The following output pieces are from outfile.seq in the example directory.
=============================================
Example for sequence data
=============================================
MIGRATION RATE AND POPULATION SIZE ESTIMATION
using Markov Chain Monte Carlo simulation
=============================================
Version 0.7
Program started at Sun May 22 23:40:38 1998
finished at Mon May 23 00:25:32 1998
Options in use:
---------------
Datatype: DNA sequence data
Random number seed (with internal timer) 674365543
Start parameters:
Theta values were generated from the FST-calculation
M values were generated from the FST-calculation
Migration model: Migration matrix model with variable Theta
Gamma-distributed mutation rate is not used
Markov chain parameters:
Short chains (short-chains): 10
Trees sampled (short-inc*samples): 10000
Trees recorded (short-sample): 500
Long chains (long-chains): 3
Trees sampled (long-inc*samples): 100000
Trees recorded (long-sample): 5000
Number of discard trees per chain: 200
Print options:
Data file: infile
Output file: outfile
Print data: No
Print genealogies: No
Plot data: Yes, to outfile and mathfile
Profile likelihood: Yes, tables and summary
This is the title and options part. Don't cut away the options, so you will
still
know a few weeks later with what kind of options and how long you
run the program.
Summary of data:
---------------
Datatype: Sequence data
Number of loci: 1
Population Individuals
-------------------------------------------------------------
1 population_number_0 25
2 population_number_1 21
Total of all populations 46
Empirical Base Frequencies
------------------------------------------------------------
Locus Nucleotide Transition/
------------------------------ Transversion ratio
A C G T(U)
------------------------------------------------------------
1 0.2461 0.2450 0.2497 0.2591 0.60000
The data summary is (too) short, and self explanatory, you can also print
the data (not shown). Print the data the first time you use the program with
your data and check if it was read correctly: I control the first and the last
individual in a population and check a few sites at both ends of the sequence.
If the program crashes shortly after the start almost certainly the data
contains some trouble. The most common error is having the wrong number
of individuals and/or number of sites.
==============================================================================
MCMC estimates
==============================================================================
Population [x] Loc. Log(L) Theta 4Nm
[4Ne mu] 1,x 2,x
-------------- ---- -------- -------- ----------------------------------------
1: population 1 2.88 0.04567 ------- 4.03909
2: population 1 2.88 0.02857 7.80435 -------
Comments:
There were 10 short chains (500 used trees out of sampled 10000)
and 3 long chains (5000 used trees out of sampled 100000)
This is the main output of the program. For each population there is a list
of all loci and the estimates and if there are more than one locus, there
is also an estimate over all loci. The ln(L) is the maximum log likelihood.
This value is a ratio
. The parameter
are
different between different runs of the program and therefore you cannot
simply compare between different runs.
The column marked Theta (
) gives the population sizes for
each population and each locus, of course the number of individuals
in that population
is for all loci the same, and the variance you see
is (a) the variance of the sampler,
(b) stochastic variance due to the coalescence
process, (c) variance of the mutation rate.
The migration parameter
is to read the following way:
in population 1, the 2,x means that the immigration from population two into one is
.
in population 2 the 1,x means that the immigration from population one into two is
If the program is also allowing for variable mutation rate (you don't want to
use that with one locus), then you will get also an estimate for the
shape parameter alpha (
) for the distribution of the mutation rates.
This will not be shown as a default, anymore. It is merely used as a starting
value for the Maximum likelihood estimates. The table are similar to the table
of the MCMC estimates.
Log-Likelihood surfaces for each of the 2 populations
-------------------------------------------------------
Legend:
X = Maximum likelihood
* = in approximative 50% confidence limit
+ = in approximative 95% confidence limit
- = in approximative 99% confidence limit
Locus 1
x-axis= 4Nm [effective population size * migration rate],
y-axis = Theta,
units = log10
Maximum log likelihood on plot
Population 1: population_number_0
Immigration: 4Nm=5.179470, Theta=0.051795, log likelihood=2.678661
Emmigration: 4Nm=13.895000, Theta=0.051795, log likelihood=2.749731
Immigration Emmigration
-3 -2 -1 0 1 2 -3 -2 -1 0 1 2
++------+------+------+------+------++ ++------+------+------+------+------++
2 + + + +
| | | |
| | | |
| | | |
| | | |
| | | |
| | | |
1 + + + +
| | | |
| | | |
| | | |
| | | |
| | | |
| | | |
0 + + + +
| | | |
| | | |
| | | |
| | | |
| | | |
| | | |
-1 + --- + + -- +
| ++*+ | | -+++++ |
| -+*X*- | | +*X*+*+ |
| ++**+- | | -+**+*+ |
| +++- | | -++-+ |
| | | |
| | | |
-2 + + + +
| | | |
| | | |
| | | |
| | | |
| | | |
| | | |
-3 + + + +
++------+------+------+------+------++ ++------+------+------+------+------++
-3 -2 -1 0 1 2 -3 -2 -1 0 1 2
For each population and each locus there will be a summary contour plot
for all immigrations and all emmigrations. These plots give some information
about the confidence you should have in the estimates. Keep in mind that
even with two populations there are 4 parameters and the likelihood.
A plot is a kind of diagonal through this high dimensional space (in this
example: 5 dimensions);
Profile likelihood for parameter Theta_1
Parameters are evaluated at percentiles
using cubic splines of profiled parameter
(faster, but not so exact).
-------------------------------------------------------------------------------
Per. Ln(L) Theta_1 *Theta_1* Theta_2 M_21 M_12
-------------------------------------------------------------------------------
0.01 -3.645 0.0223 0.0223 0.0297 81.9303 293.8230
0.05 -2.065 0.0240 0.0240 0.0297 81.9441 294.2779
0.10 -1.329 0.0250 0.0250 0.0297 81.9766 294.5011
0.25 -0.284 0.0266 0.0266 0.0296 82.0709 294.7953
0.50 2.878* 0.0457 0.0457 0.0286 88.4385 273.2104
0.75 0.324 0.0789 0.0789 0.0279 96.2738 252.5011
0.90 -1.065 0.0900 0.0900 0.0277 97.4555 251.1683
0.95 -1.910 0.0966 0.0966 0.0277 98.0544 250.5631
0.99 -3.884 0.1119 0.1119 0.0276 99.2213 249.4557
-------------------------------------------------------------------------------
- = not possible to evaluate, most likely value either 0.0 or Infinity
in the parameter direction, the likelihood surface is so flat
that the calculation of the percentile(s) failed.
The profile likelihood table give you some idea how the parameters vary
when we hold one constant. In the default setting the program tries to
find the parameter values that are at percentiles.
How this is done for
: (1) calculate the likelihood value for
a few values smaller and bigger than the ML-estimate. (2) calculate a spline
function. (3) find the
that is at the percentile
using the
splines. (4) recalculate the likelihood and maximize the other parameter again
using the full formula. In the example,
varies almost independently from the others, looking more closely it seems that
slightly
shrinks while
grows.
===============================================================================
Summary of profile likelihood percentiles of all parameters
===============================================================================
Parameter Lower percentiles
-------------------------------------------------------------------
0.01 0.05 0.10 0.25 0.50
-------------------------------------------------------------------------------
Theta_1 0.02228 0.02399 0.02497 0.02664 0.04567
Theta_2 0.00946 0.01188 0.01331 0.01567 0.02857
M_21 30.53718 36.49126 39.97529 46.64759 88.43845
M_12 114.08445 132.49441 143.22648 163.32323 273.21045
Parameter Upper percentiles
-------------------------------------------------------------------
0.50 0.75 0.90 0.95 0.99
-------------------------------------------------------------------------------
Theta_1 0.04567 0.07889 0.09003 0.09660 0.11190
Theta_2 0.02857 0.05709 0.07586 0.09833 0.15052
M_21 88.43845 201.06595 215.26333 225.18048 245.85767
M_12 273.21045 805.85153 896.08361 957.07762 1083.66503
-------------------------------------------------------------------------------
- = not possible to evaluate, most likely value either 0.0 or Infinity
in the parameter direction, the likelihood surface is so flat
that the percentiles cannot be calculated.
This summarizes only the likelihood and profile parameter column in the
profile likelihood tables and can be used to give some idea about the
confidence you should have into the estimates.
has a approximative 90%-confidence interval from 0.02399 to 0.09660
with a best estimate of 0.04567.
(the data was simulated with a
, for further ``true'' values
see the README in the example directory.
This section will increases when I get more feedback.
The order of the questions/answers is probably random or historical.
- The program crashes! Your program has a bug!
- The program crashes with large but not with small data sets,
what is wrong?
- How can I code haploid data for Migrate?
- Can I use haplotype frequencies as input?
- Can I use gene frequencies as input?
- It run with the default number of chains etc. Has it run
long enough?
- How long does it run?
- Can migrate run on multiple machines in parallel?
- I have haploid data, what is
?
- I have mtDNA sequence data what is
?
- How should I interpret each of the 4Nm estimates for pair i,j?
- Why are the Likelihood values different between runs?
- Why do I have positive numbers in the Ln(L) column?
- I have problems to understand what are the Null-hypothesis and the alernative hypothesis in the likelihood ratio test section.
- The program crashes! Your program has a bug!
Sure, this program most likley has some bugs, but more likely is that
the infile is not correct, and without more detail about
what went wrong there is
little hope for help.
- The program crashes with large but not with small data sets,
what is wrong? [System description... + part of log]
- General: Most often mistakes in the infile, such as wrong number
loci or populations or individuals or number of sites or using few characters for the individual names, let the program crash almost immediately after the
menu. Check the infile carefully and compare with the data file specifications.
- on Macintoshes: the preferred memory consumption of migrate is set to 20MB RAM, for larger problems, such as many populations or
many loci or long chains, this can produce cryptic crashes (e.g.
Error in calloc() in file broyden.c line xxx). Try increase the memory.
You single-click the icon of migrate, go to the File menu and
choose Get Info and in there Memory. Set the preferred Size
to some higher value. If you have 128 MB RAM and your System is
consuming already around 30 MB, you can set the program up to something like
80 MB, but then if you run other programs it will swap parts of the RAM into
virtual memory. If some part of migrate are swapped into onto disk
by the virtual memory manager the program will most likely not finish because
because the program is slowed down to a crawl.
- on Windows: I need to know about this, but so fare the latest binaries,
seem to have no trouble with preset memory.
- I have haploid allelic data, how should I structure my infile
Unfortunately, I was biased towards diploid data for microsatellite and
enzyme electrophoretic data and you need to fake diploids for the infile.
Your microsatellite exampled data look like this:
Locus1 Locus2 Locus3 Locus4 Locus5
Ind1 11 45 14 15 89
Ind2 11 47 13 15 67
Ind3 11 43 13 15 67
Ind4 12 47 13 15 73
Ind5 11 45 13 15 89
And your infile should look like this
2 5 . Example input for haploid microsatellite data
5 Fake diploid population 1
Ind1 11.? 45.? 14.? 15.? 89.?
Ind2 11.? 47.? 13.? 15.? 67.?
Ind3 11.? 43.? 13.? 15.? 67.?
Ind4 12.? 47.? 13.? 15.? 73.?
Ind5 11.? 45.? 13.? 15.? 89.?
4 Fake diploid population 2
..data not shown..
Or
2 5 . Example input for haploid microsatellite data
3 Fake diploid population 1
Ind1Ind2 11.11 45.47 14.13 15.15 89.67
Ind3Ind4 11.12 43.47 13.13 15.15 67.73
Ind5???? 11.? 45.? 13.? 15.? 89.?
4 Fake diploid population 2
..data not shown..
The ``?'' are removed for the analysis (But recognize that in sequence data the
? are not removed.
- Can I use haplotype frequencies as input?
No, input formats are a rather arbitrary matter, and I decided that
you need to input each single sequence of genotype. I principle it
would be easy to add a ``frequency'' input mode, but currently
I have not time to do that. But keep asking for it, if this is so
important to you.
- Can I use gene frequencies as input?
No, not yet, this is on the todo list, but has a rather low
priority. To circumvent the problem, you can create artificial
genotypes for the infile. The genotypes themselves are not important.
A simple script that assigns alleles to individuals will do, this
can be written in almost any scripting language from excel (yikes!),
word-macro (yikes!), Perl, C, C++, applescript, Mathematica, ... for throw away programs I use Perl5.1, Mathematica5.2, or C5.3.
- It run with the default number of chains etc. Has it run
long enough?
this depends on the number of populations you want to analyze.
If you have one it will be almost certainly enough. But if you
try to analyze 6 or more it almost certainly will not. You need to experiment a little with the length of chains. See chapter 3 (Accuracy of results).
- How long does it run?
With progress=Yes the program tries to estimate the length
of a run from the work it has done so far, after the first short chain
this may be rather imprecise, but you may realize that you need to
wait minutes or days (just imagine you estimate the time to travel
from Spokane to Seattle in a car and estimate when you will arrive
only using the distance and time you have finished already).
The time calculated is only based on the genealogy
search, and does not include the time to create the plots for each
locus and population. Therefore, if you have many populations and many loci
you can expect to wait longer than the time stamp indicates. There is
an additional time estimate for the profile-likelihoods.
- Can migrate run on multiple machines in parallel?
Short answer: No. Long Answer: If you use the heating option
and your machine is a symmetricf multiprocessor machine and you
compiled with make thread then the program will utilize maximally
4 processors. This will improve the heated search by about a factor of 3.
I am currently working on an implementation of migrate that will use the
message passing interface (MPI), and this would spread the loci over
processors, but this update is not coded yet.
- I have haploid data, do I have to multiply my
,
and
?
The
you get with haploid data is
. Comparing with other values for haploid data should be fine, but you need to multiply
when you compare it with a
from diploid data.
- I have mtDNA data, do I have to multiply my
,
and
?
See question above, but in most vertebrates mtDNA is only passing through the maternal
lineages and is haploid, for a comparison with diploid data
you should multiply by 4.
- How should I interpret each of the 4Nm estimates for pair i,j? as
($4 ×#times;N_e ×#times;$ migration rate from j to i)?
Then, can I take 17 times (for 18 demes) this number as
(migration rate into i)
Yes, the overall immigration rate into i is
total immigration rate into population i
but I personally tend to report

or
- Why are the likelihoods between runs different?
The likelihoods are really ratios
and we run several chains and update the
between chains.
For a comparison we would need that
the second last chain of each run delivers exactly the same
parameters, which we then would use for the comparison. A possibility is
to run only one long chain in each run with some given parameters
. This not really recommended if the start values are not
very close to the true parameters.
- Why do I have positive numbers in the Ln(L) column?
See also question before.
the Ln(L) is actually a ratio (see Beerli and Felsenstein 1999, we have a
derivation of this ratio in the appendix, but this can be found in
statistics books that talk about MCMC)
In our case we try to maximize
its MCMC derivation is
In fact, the
should be rather close to 0.0,
but this is dependent on the number
parameters (I think) that produce noise,
with many parameter it will be not very close
to 0.0, but with just one param (single population) the value
is more like 0.00x, with 16 parameter it seems more like 5-30.
If you have more than one locus then it is likely that when
they produce rather different results, that the value will go negative.
- I have problems to understand what are the Null-hypothesis and the alernative hypothesis in the likelihood ratio test section?
The easiest way to answer is with an example:
Assume you just run migrate-n and got the following results:
,
,
, and
. Now you want to test if the population sizes are the
same or not and if the migration rates
are the same or not.
This would ask for a Null-hypothesis so that
and
[
].
Recognize that we would use here
and not
, but that you still need to specify
your values to check in terms of
.
the Alternative hypothesis is then
and
. For this above test you can specify it in several ways:
- l-ratio=Means:m, m, m, m [easiest]
- l-ratio=Means:0.0265, 0.0265, 0.34, 0.67
For the second example, you need to calculate by hand first
the
and then from that recalculate the
when
the
are the same, I used the average. Because the
input for the likelihood ratio test is in terms of
and
not
.
The errors are in no particular ordering, but
I will move more important ones to the beginning of their sections.
The program aborts when it encounters one of the following conditions.
Of course there are certainly conditions
I have not thought of.
SEVERE ERROR: ....
Most often your infile contains a problem (e.g. number of sites
does not match the number actual sites given, number of individuals
does not match). If you fail to correct the problem. please contact me.
ERROR: Datatype is wrong, please use a valid data type!
ERROR: the program will crash anyway, so I stop now
You probably specified a wrong letter for the data type in the parmfile
ERROR: Wrong datatype, only the types a, m, s, n
ERROR: (electrophoretic alleles,
ERROR: microsatellite data,
ERROR: sequence data,
ERROR: SNP polymorphism) are allowed.
You probably specified a wrong letter for the data type in the menu
ERROR: The parmfile contains an error on line XX
There was a wrong entry or even more likely wrong values in the parmfile on line xx.
ERROR: Inconsistency between your Menu/Parmfile and your datafile
Most likely your parmfile assumes there are n subpopulations and
you assume m subpopulations. Problems with the migration matrix are likely.
ERROR: There is a conflict between your menu/parmfile
ERROR: and your datafile: number of populations are not the same
Most likely your parmfile assumes there are n subpopulations and
you assume m subpopulations.
ERROR: cannot find seedfile
You specified that the random number is in seedfile,
but the file is not present
in the directory migrate is running.
ERROR: Failure to read seed method, should be
ERROR: seed=auto or seed=seedfile or seed=own:value
ERROR: where value is a positive integer
Either seed specification in seedfile or parmfile is wrong.
ERROR: Failure to read start theta method, should be
ERROR: theta=FST or theta=Own:x.x
ERROR: or theta=Own:{x.x, x.x , x.x, .....}
ERROR: migration=Own:migration value
the start parameters are not correctly specified.
ERROR: Failure to read start migration method
the start parameters are not correctly specified.
ERROR: Custom migration matrix was completely set to zero?!
the custom migration matrix was not correctly specified.
WARNING: migration limit (xx) exceeded: yy
WARNING: results may be underestimating migration rates
WARNING: for this chain
If this happens only a few times in short chains, don't worry. If it happens
in the last chain or very often, then your migraiton estimates will be most
likely underestimated, but the migration rates between these populations will
be very high, anyway. It means that there is an upper limit of possible migration events on the genealogies, and this is set as a default to
number_of_populations
1000.
WARNING: Migration forced
WARNING: results may overestimate migration rates
WARNING: for this chain
Migration rate is essentially 0.0, the program proposes sometimes a migration
event even so the probabilities would foce a coalescence, this heuristic
helps to escape the fatal attraction to 0.0.
If 4Nm is smaller than 0.1 the program will propose randomly every tenth
event a migration event. This genealogy has then still to be accepted.
Hitting this boundary can produce an upwards bias, but it should be
only be recognizable when your populations are barely connected, if at all.
WARNIN`G: This does look like sequence data
WARNING: I just read a number of sites=0
WARNING: If you use the wrong data type, the program will abort
Check your datatype!
WARNING: -------------------
WARNING: Target branch problems with time=xx
WARNING: -------------------
If you encounter this, abort the program, and try to find the error
in the infile, but if the data prints conrrectly,
please contact me. Probably I should declare this
a severe error and abort.
WARNING: proposed and new likelihood differ: xx != yy
WARNING: abort the program and try to find the errors
WARNING: there could be a wrong datatype, or infile
WARNING: to check the data you can print it (see menu)
If you have problems to resolve this error (check for errors in infile),
please contact me and try to give as much information
as you can (including your dataset).
WARNING: Inappropiate entry in parmfile: keyword ignored
The keyword of a parmfile entry was wrong, often misspelled.
WARNING: You forgot to add your guess value:
WARNING: Theta=Own:pop1,pop2, ...
WARNING: or Theta=Own:guess_pop (same value for all)
You probably specified Theta=Own and forgot to say what values.
WARNING: You forgot to add your guess value, use either:
WARNING: migration=FST
WARNING: or migration=Own:{guess_4Nm} (same value for all)
WARNING: or migration=Own:{ - 4Nm21 4Nm31 .... 4Nm12 - 4Nm23 ...}
You probably specified migration=Own and forgot to say what values.
See the parmfile section, about how to give the migration values.
If you think you have found a bug please report this to
beerli@genetics.washington.edu.
I would like to know every warning you see while you compile the program, if you send me
bug-reports please include your hardware and system specifications, your
infile, your parmfile (if any), and
a ``printout'' of the warnings or errors.
BUT, mostly, the problem is that the data in the infile is in a wrong format:
you can expect the program to crash when you try to use
the datatype=Allelic and your
infile contains sequence data.
I am trying to reduce the number of strange error messages,
but this has lower priority than adding new features/improving code.
Please, before you report a bug, compare your infile with the examples.
Migrate can be fetched from our www-site
( http://evolution.genetics.washington.edu/lamarc.html)
and is free for non commercial use.
Currently we have the following packages available
| migrate.tar.gz |
Source |
| migdoc-0.9.6.pdf |
Documentation [this document you are reading] |
| migrate-0.9.6.src.pm.sea.hqx |
Source for Powermac (Metrowerks) |
| migrate-0.9.6.powermac.sea.hqx |
Powermac binaries |
| migrate-0.9.6.bsdintel.tar.gz |
Dec Alpha DUNIX binaries |
| migrate-0.9.6.macosx.tar.gz |
Mac OS X server binaries |
| migrate-0.9.6.linux.tar.gz |
LINUX binaries |
| migrate-0.9.6.solaris.tar.gz |
SUN Solaris binaries |
| migrate-0.9.6win.exe |
WindowsNT/9*/2000 self extracting archive |
On UNIX system unpack with tar xvfz migrate.[system].tar.gz or
gunzip -c migrate0.9.6.[system].tar.gz | tar xf -.
This builds a directory migrate-0.9.6
with a subdirectory examples,
the files README, HISTORY, and the programs
migrate and migrate-n.
The program can be moved to a location like /usr/local/bin
and the documentation (HTML files are in documentation/migratedoc) to
your HTML directory (e.g. /usr/local/etc/httpd/htdocs).
On Powermacs or Windows machines double click the archive
and a folder system similar the UNIX directories above will be created.
- gunzip -c migrate0.9.6.tar.gz
tar xf - or
tar xfz migrate0.9.6.tar.gz
this creates a directory "migrate-0.9.6" with "src" and "examples" in it.
- cd migrate-0.9.6
- ./configure
(this scripts checks your system and will report
functions the program needs, if a function is not, it will report an error,
which I need to know. I assume that your machine has gcc installed,
but configure tries to be smart about other compilers:
on SGI and DEC ALPHA without gcc it will use the native
compiler with the approriate options. You can force this behavior
with bash shell: CC=cc ./configure, in csh shell: env CC=cc ./configure
- make
(please report warnings and especially errors)
the result should be a binary migrate in the migrate directory.
If you have a multiprocessor machine that has the POSIX thread library
installed (the configure script searches for libpthread and pthread.h)
try to use make thread, this will allow to run the heated chains
in parallel and so should speed up the program if you use heating.
- make install
(this will install the program and man-page into usr/local/bin, /usr/local/man/man1
; you need to be root to do this; this step is not necessary)
The source code for the Powermac is the same as the general source code but it is packaged
with a minimal graphical interface file and a Metrowerks Codewarrior project, which should make it very easy to compile (if you have a very recent Metrowerks compiler).
- Unpack (it is a self extracting archive).
- Open the migrate.mcp file and use the submenu Make
(I compiled with Metrowerks CodeWarrior Pro 5)
- Send me a reprint if you used Migrate for your publication.
- Cite the documentation and our paper, see below.
- Report problems to beerli@genetics.washington.edu
- Suggestions (if you need these improvements very soon,
add a check so that I can hire a programmer to implement
all those
)
Please cite:
- Beerli, P.
- 1997-2000. MIGRATE 0.9.6: documentation and program,
part of LAMARC. Revised March 3 2000. Distributed over the Internet,
http://evolution.genetics.washington.edu/lamarc.html
[Downloaded: ...date....]
- Beerli, P., and J. Felsenstein.
- 1999. Maximum likelihood estimation
of migration rates and population numbers of two populations using a coalescent approach. Genetics 152(2): 763-773.
- Beerli, P.
- 1998. Estimation of migration rates and population sizes in geographically
structured populations. In Advances in molecular ecology (Ed. G. Carvalho). NATO-ASI workshop series. IOS Press, Amsterdam. Pp. 39-53.
(c) Copyright 1996-2000 by Peter Beerli and Joseph Felsenstein, Seattle.
Permission is granted to copy this document and the program Migrate-n
and Migrate
provided that no fee is charged for it and that this copyright notice is not removed.
This project is and was supported by grants from National Science
Foundation (USA) BIR 9527687 and National Health Institutes (USA)
GM51929 and HG01989
all to Joseph Felsenstein and a fellowship of the Swiss National
Science Foundation to Peter Beerli (1994-1996). I thank Mary K. Kuhner
and Jon Yamato for help during debugging and many discussion.
And also all people who thought it worth to report errors and
foggyness in menu and explanation:
Mats Bjorklund, Allen Rodrigo, Carol Reeb, Byron Adams, Tony Metcalf,
Toby Hay, Peter Galbusera, Scott Edwards, Reinaldo Brito, Tonya Bitner,
Vicki Friesen, Cliff Cunningham, Natalie Bulgin,
Keith Crandall, Erik Simandle, Martin Damus, Ron Goldwaithe.
[List is unordered and certainly incomplete].
- Beerli, P.
- 1998. Estimation of migration rates and population sizes in geographically
structured populations. In Advances in molecular ecology (Ed. G. Carvalho). NATO-ASI workshop series. IOS Press, Amsterdam. Pp. 39-53.
- Beerli, P., and J. Felsenstein.
- 1999. Maximum likelihood estimation
of migration rates and population numbers of two populations using a coalescent approach. Genetics 152(2): 763-773.
- Casella, G., and R. L. Berger
- 1990. Statistical inference. Duxbury Press, Belmont, California.
- Chib, S., and E. Greenberg. 1995
- Understanding the Metropolis-Hastings algorithm. American Statistician 49: 327-335.
- Di Rienzo, A., A. C. Peterson,
- J. C. Garza, A. M. Valdez, M. Slatkin, and N. B. Freimer 1994. Mutational processes of simple sequence repeat loci in human populations.
Proc. Natl. Acad. Sci. USA 91: 3166-3170.
- Geyer, C. 1994.
- Estimating Normalizing Constants and Reweighting Mixtures in Markov Chain Monte Carlo. Technical report, University of Minnesota Nr. 568 R(4).
- Geyer, C. and E. A. Thompson. 1994.
- Annealing Markov chain Monte Carlo with Applications to Ancestral Inference. Technical report, University of Minnesota Nr. 589 R(1).
- Felsenstein, J. 1993.
- PHYLIP 3.5: Phylogeny Inference Programs. Pro gram package and documentation distributed by the author. Department of Genetic s, University of Washington, Seattle.
- Felsenstein, J. and G. A. Churchill. 1996.
- A hidden markov chain approach to variation among sites in rate of evolution.
Genetics .
- Hammersley, J. M. and D. C. Handscomb. 1964.
- Monte Carlo methods. Methuen, London.
- Hudson, R. R. 1990.
- Gene genealogies and the coalescent process.
Oxford Surveys in Evolutionary Biology 7: 1-44.
- Kimura, M. and T. Ohta. 1978.
- Stepwise mutation model and distribution of allelic frequencies in a finite population. Proc. Natl. Acad. Sci. 75: 2868-2872 .
- Kingman, J. F. C. 1982a.
- On the genealogy of large populations.
pp. 27-43 in Essays in Statistical Science,
ed. J. Gani and E. J. Hannan. London: Applied Probability Trust.
- Kingman, J. F. C. 1982b.
- The coalescent.
Stochastic Processes and their Applications 13: 235-248.
- Kishino, H. and M. Hasegawa. 1989.
- Evaluation of the maximum likelihood
estimate of the evolutionary tree topologies from DNA sequence data, and the
branching order in Hominoidea.
Journal of Molecular Evolution 29: 170-179.
- Kuhner, M. K., J. Yamato, and J. Felsenstein. 1995.
- Estimation effective population size and mutation rate from sequence data
using Metropolis-Hastings sampling. Genetics 140:1421-1430 .
- Kuhner, M. K., P. Beerli, Jon Yamato, and Joseph Felsenstein. 2000.
- Usefulness of single nucleotide polymorphism (SNP) data for estimating population parameters. Genetics 156(1).
- Maynard Smith, J. 1970.
- Population size, polymorphism, and the rate of non-Darwinian evolution.
American Naturalist 104: 231-237
- Meeker, Q., and L. A. Escobar. 1995
- Teaching about approximate confidence regions based on Maximum Likelihood
estimation. American Statistician 49: 48-53.
- Nath, H., B., and R. C. Griffiths. 1993.
- The coalescent in two colonies with symmetric migration.
Journal of Mathematical Biology 31: 841-851.
- Notohara, M. 1990.
- The coalescent and the genealogical process in
geographically structured population. Journal of Mathematical Biology
29: 59-75.
- Ohta T. and M. Kimura. 1973.
- A model of mutation appropriate to estimate
the number of electrophoretically detectable alleles in a finite population.
Genetical Research 22: 201-204.
- Slatkin, M. 1995.
- A measure of population subdivision based on microsatellite allele
frequencies. Genetics 139: 457-462.
- Swofford, D., Olsen, G., Waddell, P., and Hillis, D. 1996.
- Phylogenetic inference. In Molecular Systematics, edited by
D. Hillis, C. Moritz, and B. Mable, pp. 407-514,
Sinauer Associates, Sunderland, Massachusetts.
- Valdes, A. M., M. Slatkin, and N. B. Freimer. 1993.
- Allele frequencies at microsatellite loci: the stepwise mutation model
revisited. Genetics 133: 737-749.
If you have access to the program Mathematica, you can open the
lamarc.example.ma in the example directory. With it you can create nicer
likelihood surface plots than the ones you see in the outfile.
Example:
[people] in brackets helped to find bugs/problems.
- July 22 2000 MIGRATE-N 0.9.6 Addition of a logfile option,
the gamma deviated mutation rate among loci seems to work
but needs more rigorous testing, so sometimes it will still
fail.
- July 11 2000 MIGRATE-N 0.9.5 Bug fixes: the addition of a null population
should work now for all datatypes [Martin Damus],
under some conditions the maximizer
gave up too quickly, and (an embarassing one) for profile
likelihood percentiles miscalculation of percentile values:
some of the old percentiles were wrong, To see what impact it
had on your conclusions see below
correct/:1
wrong/old: 0.5
The old tables were using the 1,5,10... labels but calculated
values under "wrong/old".
[the likelihood ratio tests are not affected by this]
The new profile tables are set so that you can generate
99
[mutation=Gamma is still broken, sigh]
- May 30 2000 MIGRATE-N 0.9.4
Fixed a bug in reading and writing summary files
(options affected were write-summary and datatype=genealogy).
mutation=Gamma is still broken [Eric Simandle],
do not use it.
- May 12 2000 MIGRATE-N 0.9.3
embarrased to say but the last fixed introduced a problem,
in the likelihood calculation, hopefully fixed now.
mutation=Gamma is still broken [Eric Simandle],
do not use it.
- April 22 2000 MIGRATE-N 0.9.2
inconsistency in likelihood calculation with replication
fixed.
- April 21 2000 MIGRATE-N 0.9.1
Bug in Mac-version of automatic random number seed
generation, and in recording start migration parameters fixed,
and migration start parameter mix up in parmfile
fixed [all Ken Wahrheit].
Heating scheme changed, implemented a 4 parallel chain
heating scheme (simulated tempering) based on Geyer and
Thompson. The Tempered transition method (Neal) will
be reimplemented in a later version.
Fixes: ttratio now works for different values
[Judite Alves],
Registered users: 423
(tried to find this time all doubles)
- March 3 2000 MIGRATE-N 0.9
First introduction of estimation of parameters over multiple chains or multiple runs.
The strict two-population version Migrate-0.4 is removed from this
distribution, although it will be still
available separately. Multiple chain/runs with the combination of gamma deviated mutation rate does not work yet. Heating scheme is broken.
Registered users: 430
- December 10 1999 MIGRATE-N 0.8.5
Change of defaults: plot=FALSE, moved eventloop()
in plot routine for Macintosh.
- December 2 1999 MIGRATE-N 0.8.4
Revision of likelihood ratio test output. Change
of "burn-in" default from 200 to 10000.
Minor speedups in several functions.
- November 23 1999 MIGRATE-N 0.8.3
Revision of heating scheme [note it is still broken].
- November 5 1999 MIGRATE-N 0.8.2
Addition of a convergence criterium: Gelman's R,
(use progress=verbose)
Added material to the
likelihood ratio test documentation.
Several minor bugfixes (sumfile related [Tonya Bittner],
Profile Quantile table, verbose Progress reporting)
Registered users: 372
- September 7 1999 MIGRATE-N 0.8.1
More cleanup of C-code, incorporation of new spline
routine ( but this is still experimental). Improvement
of documentation.
- August 20 1999 MIGRATE-N 0.8
A problem with the UPGMA starting tree fixed,
with many individuals the starting tree contained
some silly ordering, that produced uneven number of
migration events on this tree and needs rather a long
time to recover from this.
profile likelihood speed improvements when there is a
custom-migration matrix with zeroes.
Registered users: 322
- June 4 1999 MIGRATE-N 0.7.1
Division by 0 bug fixed in fst-calculation, this seems
to bother only DEC Alphas.
- May 19, 1999 MIGRATE-N 0.7
Updated documentation, several minor things, warnings and error
reporting should be more consistent, I am adding a section to
the manual that describes all error/warning messages [partly
done], the plotting graphics are more flexible now, but still
need more work. You can specify the range and type of
axes (log-scale, std-scale), and if the migration parameter
shall be plotted as M=m/mu or 4Nm. Fix of inconsistency
in migration value menu input [Reinaldo Brito].
Fix of an error in the
profile-method=FAST (it will need now more time to finish,
because it is doing the final maximization over all other
parameters), if you want its old behavior, that assumes that
Theta and M are not correlated [not a too bad assumption],
then use profile=YES:QUICK.
- Feb 14, 1999 MIGRATE-N 0.6.3
Updated documentation (fixed errors in description of
random-seed options, added important material
to profile-likelihood) ,
inclusion of improved man page,
fixed configure for SGI's with out gcc.
- Oct 11, 1998 MIGRATE-N 0.6
Addition of datatype=n that is for single nucleotide
polymorphism data, no simulation with this kind of data
is yet done, so I do not know about biases etc.
Profile tables now report 4Nm instead of m/mu for
the migration parameters.
Documentation contains now more about what you can and
cannot do with the reported log(likelihood) values
[Mats Bjorklund].
Binaries for OPENSTEP available [thanks to Magnus Nordborg
giving me an account on his machine].
Registered users: 206
- Sep 1, 1998 MIGRATE-N 0.4/0.5 [was not released, was too busy with
other things]
FST start values work now also for microsatellite data
but I still need to check the correctedness of the FST table
when the data are microsatellites.
Fixed wrong emmigration plots. Fixed wrong start
calculations for allelic data when a delimiter was used,
and several minor bug fixes. Profile-method
"uncorrelated" from version alpha.1 recovered.
Registered users: 197
- June 14, 1998 MIGRATE-N alpha.3 and MIGRATE-0.4.2
Several minor changes in migrate-n: menu addition for
-profile method:
profile-method=<Spline | Percentiles | Discrete>
Spline: uses 1-dimensional splines to find percentiles,
faster than the "Percentiles" option but not so accurate,
"Discrete" evaluates at "fixed" (0.02, 0.1, 0.2, 0.5, 1, 2,
5, 10, 50) * MLE of parameter.
-with progress=yes you can see now a rough prognosed time
of end of sampling genealogies and if you use profiles
an estimated time of finishing.
-Fix of reading in intermediate results (sumfile).
-Most importantly a (hopefully) stable compile for
Windows, I failed to find the cause why the program
compiled with WATCOM failed to finish with "bigger" data sets,
it is now compiled with mingw32/gcc-win32, this is
a windows port of the same system I am using on my workstation.
Please report failures, I can only try a limited set of
examples.
Migrate-0.4.2: new windows binary (using mingw32/gcc-win32)
Registered users: 163
- May 30, 1998 MIGRATE-N alpha.2 and MIGRATE-0.4.1
With more than 2 sequence loci, there was a problem
with the T/T-ratio, when the ratio was not specified
for each locus.
Start parameter problems with microsatellite data fixed
[Mats Bjorklund].
Persistent problems with Windows executable
sometimes I get floating point errors, on all other systems
this does not occur.
Registered users: 153
- May 29, 1998 MIGRATE-N alpha.1 and MIGRATE-0.4
Memory bug in FST calculation found and fixed
[Daniel Yeh]
No change of Migrate-0.4
Registered users: 148.
- May 26, 1998 MIGRATE-N and MIGRATE-0.4
This release has the two population version (Migrate-0.4)
and an alpha-version of Migrate-n that can solve migration
matrix population model with unequal population sizes and
unequal migration rates for n populations, I tried up to 10
and the results where fine, but I am pretty sure that if
you try to feed in all your date of 100 subpopulation it
will (a) probably crash, but more importantly (b) will
need TERRIBLY long to run.
I would like to get some
feedback about what you want to see in the outfile,
menu etc. Registered Users: 138.
- March 18, 1998: MIGRATE 0.4
Update of the manual, but still not complete.
More complex sequence evolution models (categories,
weights, autocorrelation etc.) should work now,
it was broken. Cleanup of some output file lines, and
some menu entries. The FST estimation (Remember FST is only
used to generate start parameter values) is
in pre 0.4 versions logically flawed. It estimates
2 parameters per population using F_within and F_between,
but there is only 1 F_between. Correctly, we can
only estimate maximally 3 parameters with 1 locus for
two populations. I added an option into the MENU and into
the PARMFILE (fst-type=
Theta
Migration
) with which you
can decide which parameter is considered the same for both
populations.
Registered users: 103
- August 20, 1997: MIGRATE 0.3.1
Confusing menu entries for start theta and 4Nm values
fixed [Carol Reeb], the start migration values are now
4Nm and *not* m/mu values as before. Automatic Random
number seed on Macs and perhaps on other Systems
delivered sometimes negative values, now fixed
[Carol Reeb], although I would recommend to use your
own random number seeds: best values are 4n + 1 in the
range of 5 .. 2147483647, so there are plenty of
start random number seeds. Menu entry for
usertree options should be no more clear, the usertree
options needs a genealogy with migration events on
it [Tony Metcalf]. Currently MIGRATE can construct
those, or you have to do it by hand, if you need to do
this send me email, because the doc is not updated.
Registered users:52
- June 20, 1997: MIGRATE 0.3.0
Brownian motion approximation to stepwise mutation
model for microsatellites added. Solved problems:
Input problems with microsatellites data, major memory
allocation problem for datasets with more than 100
gene copies fixed [Carol Reeb]. Update of some
citation and FST output tables [Byron Adams].
Persistent problems: Long sequences AND high number of
individuals need much longer chains than the proposed
default. Try ten times longer "long" chains. Or use
the option "moving-steps".
Registered users:38
- May 12, 1997: MIGRATE 0.2.1a
Fixed problems: Interleaved sequence data
should work now, last character of individual names is
now printing, and printing of second population data
should work, too, although the EP data printout is
still ugly. [Allen Rodrigo]. Memory problem with some
Allelic data fixed.
Registered users: 30
- April 30, 1997: MIGRATE 0.2a
Fixed problems or changes: Corrections of several
minor problems, Printing of the data fixed, but still
ugly; Memory problem with large sequences fixed.
Options: treefile added, can write now a genealogy
with migrations; the option progress=Verbose for more
information during a run, the progress=Yes gives now
less information than before. Output: covariance
matrix for combined loci now prints, too. Persistent
problems: -Long sequences need very long chains to
remove the starting conditions for the migration rate
from the first tree (see documentation).
-Microsatellites still have probably a bias downwards
in Theta, but I need more simulations to make this
more clear.
Registered users: 8
- March 4, 1997: First trial release of MIGRATE 0.1a
This release is not announced widely, because I have
to test, almost everything including all HTMLs,
registration, and the program itself: simulations need
time. Registered users: 1
Peter Beerli
2000-07-26